Laporkan Masalah

POLIMORFISME GEN GROWTH HORMONE (GH) TERHADAP SIFAT PRODUKSI SUSU SAPI FRIESIAN HOLSTEIN DI BALAI PEMBIBITAN TERNAK UNGGUL HIJAUAN PAKAN TERNAK (BPTU-HPT) BATURRADEN

DIAN KURNIAWATI, Tety Hartatik, S.Pt., Ph.D.

2014 | Tesis | S2 Ilmu Peternakan

Penelitian ini bertujuan untuk mengetahui polimorfisme gen GH pada Sapi FH, melihat frekuensi alel dan genotip, serta mencari hubungan antara genotip dan asal bangsa terhadap sifat produksi susu. Penelitian dilakukan di BPTU-HPT Baturraden dan Laboratorium Pemuliaan Fakultas Peternakan UGM. Sampel yang digunakan 62 ekor Sapi FH, yang terdiri dari 19 ekor Sapi FH eks impor New Zealand dan 43 ekor Sapi FH eks impor Australia. Sampel darah diambil untuk analisis DNA yang meliputi, isolasi DNA metode SDS-PK modifikasi, amplifikasi DNA metode Polymerase Chain Reaction (PCR) menggunakan sepasang primer, GH-Forward: 5’GCTGCTCCTGAGG GCCCTTC-3’ dan GH-reverse: 5’CATGACCCTCAGGTACGTCTCCG-3’, serta penentuan genotip dengan metode Restriction Fragment Length Polymorphism (RLFP). Hubungan antara genotip dan asal bangsa terhadap sifat produksi susu diketahui dengan analisis Randomized Complete Block Design (RCBD). Identifikasi polimorfisme gen GH dilakukan dengan digesti fragmen DNA spesifik 211 bp menggunakan enzim Alu I. Hasil penelitian menunjukkan bahwa pada hasil sekuensing ditemukan adanya Single Nucleotide Polymorphism (SNP), substitusi sebuah nukleotida cytocin (C) terhadap guanine (G) pada posisi 2141 (GenBank Accession No.M57764) yang mengakibatkan perubahan urutan asam amino Leusin (CTG, alel Leu) menjadi Valin (GTG, alel Val). Sapi FH eks impor New Zealand memiliki frekuensi alel L sebesar 0,92 dan alel V 0,08 sehingga genotip LL sebesar 0,84; genotip LV sebesar 0,16. Sapi FH eks impor Australia memiliki frekuensi alel L sebesar 0,90 dan alel V sebesar 0,10 sehingga genotip LL sebesar 0,79; genotip LV sebesar 0,21. Pengaruh genotip terhadap produksi susu, kadar lemak dan kadar protein menunjukkan hasil yang berbeda tidak nyata. Pengaruh asal bangsa terhadap kadar lemak dan kadar protein menunjukkan hasil yang berbeda nyata. Kesimpulan dari penelitian ini adalah terdapat polimorfisme gen GH pada sapi FH di BPTU-HPT Baturraden, baik pada sapi FH eks impor New Zealand maupun sapi FH eks impor Australia. Tidak terdapat hubungan antara genotip terhadap sifat produksi susu, namun genotip LV cenderung menunjukkan hubungan yang positif terhadap produksi susu. Terdapat hubungan antara asal bangsa terhadap kadar lemak dan kadar protein dimana sapi FH eks impor Australia memiliki kadar lemak dan kadar protein yang lebih tinggi daripada sapi FH eks impor New Zealand. Kata kunci: Polimorfisme, Gen GH, Sifat produksi susu, Sapi Friesian Holstein

The research was conduct to know polymorphism GH gene and allele frequency of FH, and associated of effect of genotype and breed with milk yield, fat and protein content. The research was conduct at BPTU-HPT Baturraden, and Animal Breeding Laboratory UGM. The research was use 62 FH at BPTUHPT Baturraden, consist of 19 FH imported from New Zealand and 43 FH imported from Australia. Blood sampel for DNA molecular analysis was conducted by DNA isolation with SDS-PK modification method, DNA amplification with Polymerase Chain Reaction (PCR) method use the primer pair, GH-Forward: 5’-GCTGCTCC TGAGGGCCCTTC-3’ and GH-reverse: 5’- CATGACCCTCAGGTACGTCTC CG-3’, and digesti with Restriction Fragment Length Polymorphism (RLFP) method. Association between effect of genotype and breed with milk production can know by Randomized Complete Block Design (RCBD) analysis. Identification of GH gene polymorphism was conducted by digested the DNA fragment of 211 bp by Alu I enzyme. The result indicated that Sequencing alignment prove that the sequence of FH was found Single Nucleotide Polymorphism (SNP), where there is substitution cytocin (C) to guanine (G) at position 2141 (GenBank No.M57764) which resulted in changes in the amino acid sequence leucine to valine. Frequencies of L and V allele in FH imported from New Zealand 0.92 and 0.08 respectively with genotype LL 0.84 and LV 0.16. Frequencies of L and V allele in FH imported from Australia 0.90 and 0.10 respectively with genotype LL 0.79 and LV 0.21. In this study indicated that effect of genotype with milk yield, fat and protein content have not significant, but effect of breed with fat and protein milk content have significant. The conclusion this research showed that was found polymorphism in FH cows at BBPTU-HPT Baturraden. Associated between genotype with milk yield, fat and protein content was not found, but FH with LV genotype have positive effect for milk yield. Associated between breed with fat and protein content was found in FH cows at BPTU-HPT Baturraden. FH imported from Australia have higher than FH imported from New Zealand on fat and protein content Keywords: Polymorphism, Growth hormone gene, Milk production, Friesian Holstein

Kata Kunci : Polimorfisme, Gen GH, Sifat produksi susu, Sapi Friesian Holstein; Polymorphism, Growth hormone gene, Milk production, Friesian Holstein


    Tidak tersedia file untuk ditampilkan ke publik.