POLIMORFISME GLY972ARG GEN IRS-1 DAN G2350A GEN ACE PADA STROKE ISKEMIK
Syahrul, dr. Sp.S, Prof. Dr. dr. Samekto Wibowo, P. Farm(K), Sp S(K), Sp FK(K).
2013 | Disertasi | S3 Kedokteran UmumStroke merupakan gangguan multi faktorial yang sangat heterogen, dan mempunyai defek substansial tentang komponen genetik pada stroke iskemik. Identifikasi asosiasi genetik sebagai faktor risiko stroke yang baru sebagai penyebab stroke iskemik akan sangat membantu perbaikan strategi pencegahan stroke dan dapat menentukan target pengobatan terbaru dari stroke iskemik. Identifikasi polimorfisme Gly972Arg gen IRS-1 dan G2350A gen ACE sebagai faktor risiko stroke iskemik, sindrom metabolik, dan resistensi insulin pada penderita stroke iskemik. Telah dilakukan penelitian kasus kontrol dengan matching pada jenis kelamin dan ras pada 85 kasus penderita stroke iskemik dan 86 kontrol subjek sehat bukan stroke. Terhadap kasus stroke iskemik dilakukan pemeriksaan fisik umum, neurologi lengkap, BMI, diagnosis sindrom metabolik sesuai kriteria ATP III NHLBI 2002, pengukuran HOMA resistensi insulin mengunakan rumus HOMA-IR. Dilakukan pemeriksaan CT scan atau MRI kepala untuk pembuktian stroke iskemik, pemeriksaan EKG, laboratorium gula darah puasa, trigliserida, HDL-kolesterol, dan insulin darah puasa. Dilakukan isolasi DNA, dilanjutkan dengan pemeriksaan PCR-RFLP menggunakan enzim SmaI untuk analisis genotip Gly972Arg gen IRS-1 yang menggunakan primer 5’CTTCTGTCAGGTGTCCATCC3’ forward dan 5’TGGCGAGGTGTCCAC GTAGC3’ reverse, apabila terdapat polimorfisme maka alel GGG menjadi RGG. Untuk analisis genotip ACE dilakukan pemeriksaan lokus polimorfisme G2350A gen ACE menggunakan primer forward5’- CTGACGAATGTGATGGCCGC-3’ upstream dan reverse5’-TTGATGAGTT CCACGTATTTCG-3’ downstream, apabila terdapat polimorfisme maka alel G beubah menjadi A. Terhadap subjek kontrol dilakukan pemeriksaan yang sama, dan tidak dilakukan pemeriksaan CT scan/MRI kepala. Hasil penelitian terhadap 85 kasus stroke iskemik dengan usia rerata 57,3 tahun, dan 86 subjek kontrol dengan usia rerata 44,2 tahun. Distribusi nukleotida polimorfisme Gly972Arg gen IRS-1 pada kasus stroke stroke terdiri atas GG35 (32.2%), GR 29 (16%), RR 1 (0.5%); pada control GG 71 (41.5%), GR 13 (7.6%), RR 2 (1.9%). Distribusi nukleotida polimorfisme G2350A gen ACE pada kasus stroke iskemik terdiri atas GG 7 (4.1%), GA 34 (19.9%), AA 44 (25.7%), pada kontrol GG 6 (3.5%), GA 35 (20.5%), AA 45 (26%). Pada penelitian ini didapatkan polimorfisme Gly972Arg gen IRS-1 berperan sebagai faktor risiko stroke iskemik dengan OR 2.6 (1.27-5.27); IK 95%, p=0.008, juga berperan sebagai faktor risiko sindrom metabolik dengan OR 2.33 (1.14-4.9); IK 95%, p=0.021, sebagai faktor risiko resistensi insulin OR 4,25 (1,5-12,2); IK95%, p=0.02, dan hipertensi OR 2,02 (1,01-4,030; IK95%; p=0,045 pada pasien stroke iskemik. Polimorfisme G2350A gen ACE tidak menunjukkan peran sebagai faktor risiko stroke iskemik dengan OR 1,023 (0,56-1,9); IK 95%, p=0,941, sindrom metabolik OR 1,53 (0.76-3,55); IK95%, p=0.233, dan resistensi insulin OR 0.73 (0.08-6,21); IK 95%, p=0,379 tetapi merupakan faktor risiko hipertensi OR 2.8 (IK95%:1.5-5,4), p=0.001. Polimorfisme Gly972Arg gen IRS-1 berperan sebagai faktor risiko stroke iskemik (OR 2,6; p=0,008) dan sebagai faktor risiko sindrom metabolik (OR 2,33; p=0,021), resistensi insulin (OR 4,25; p=0,04) dan hipertensi (OR 2,02; p=0,045) pada stroke iskemik. Polimorfisme G2350A gen ACE tidak menunjukkan peran sebagai faktor risiko stroke iskemik, sindroma metabolik dan resistensi insulin pada stroke iskemik. Polimorfisme G2350 gen ACE hanya berperan sebagai faktor risiko hipertensi (OR 2,8; p=0,001) pada stroke iskemik.
Stroke is a highly heterogenous multifactorial disorder, and has substantial effect on genetic component of ischemic stroke. Identification of genetic associations as a new risk factor causing ischemic stroke could help greatly in improving strategies of stroke prevention, and can determine target for the latest treatment of ischemic stroke. Identifying Gly972Arg gene IRS-1 and G2350A gene ACE polymorphism as risk factor for ischemic stroke, metabolic syndrome, and insulin resitance in patients with ischemic stroke. Case-control study was conducted by matching the gender and race on 85 cases of patients with ischemic stroke and 86 healthy non-stroke control subjects. For ischemic stroke cases, the following was obtained general physical examination, complete neurology examination, BMI, metabolic syndrome criteria based on ATP III NLHBI 2002, HOMA resistance measurement using HOMA-IR formula, CT-scan or head MRI for ischemic stroke verification, ECG examination, fasting blood glucose measurement, triglyceride level measurement, HDL-cholesterol level measurement, and fasting blood insulin level measurement. DNA isolation followed by PCR-RFLP examination using SmaI enzyme to analyze genotype Gly972Arg gene IRS-1 which use primary 5’CTTCTGTCAG GTGTCCATCC3’ and forward ’TGGCGAGGTGTCCACGTAGC3’ reverse, if there is polymorphism then GGG nucleotides become RGG. For ACE genotype analysis, examination of locus G2350A gene of ACE polymorphism is performed using primary forward 5’- CTGACGAATGTGATGGCCGC-3’ upstream and reverse 5’-TTGATGAGTT CCACGTATTTCG- 3’ downstream, if there is polymorphism then G nucleotides become A. For control subjects, the same examinations were performed, except head CT scan/MRI. Result of the research for 85 of ischemic stroke cases with average age of 57.3 years old, and 86 control subjects with average age of 44.2 years old was as followed; distribution of nucleotides Gly972Arg gene IRS-1 polymorphism in stroke ischemic cases consist of GG 35 (32.2%), GR 29 (16%), RR 1 (0.5%), and in control cases consist of GG 71 (41.5%), GR 13 (7.6%), RR 2 (1.9%). Distribution of nucleotide G2350A gene ACE polymorphism in stroke ischemic cases consist of GG 7 (4.1%), GA 34 (19.9%), AA 44 (25.7%), and in control cases consist of GG 6 (3.5%), GA 35(20.5%), AA 45 (26%). In this research Gly972Arg gene IRS-1 polymorphism was found, and contribute as risk factor for ischemic stroke with OR 2.6 (1.27-5.27); CI 95%, p=0.008 and metabolic syndrome in ischemic stroke patients with OR 2.33 (1.11-4.9); CI 95%, p=0.021; insulin resistance as ischemic stroke risk factor, with OR 4.25 (1.55-12.2-10.9); CI 95%, p= 0.02 and hypertension OR 2.02 (1.01- 4.030); CI95%; p=0.045. G2350A gene ACE polymorphism did not show a role as risk factor of ischemic stroke OR 1.023 (0.56-1.9); CI 95%, p=0.941, metabolic syndrome OR 1.53 (0.76-3.55); CI 95%, p=0.233, and insulin resistance OR 0.73 (0.08-6.21); CI 95%, p=0.379 but show a role as risk factor of hypertension OR 2.8 (CI95%:1.5-5.4), p=0.001. Gly972Arg gene IRS-1 polymorphism take a role as risk factor of ischemic stroke(OR 2.6; p=0.008), and metabolic syndrome (OR 2.33; p=0.021, insulin resistance (OR 4.25; p=0.04) and hypertension (OR 2.02; p=0.045) in ischemic stroke patients. G2350A gene ACE polymorphism does not take a role as risk factor for ischemic stroke, metabolic syndrome, and insulin resistance but show a role as risk factor of hypertension (OR 2.8; p=0.001) in ischemic stroke.
Kata Kunci : Stroke iskemik, sindrom metabolik, resistensi insulin, polimorfisme Gly972Arg gen IRS-1 polimorfisme G2350A gen ACE dan faktor risiko.