CHARACTERIZATION OF INTERNAL TRANSCRIBED SPACER-1 (ITS-1) OF Toxocara vitulorum LARVAE
HANA A. ALI AWAD, Dr. drh. Sumartono , SU., DEA
2012 | Tesis | S2 Sain VeterinerToksokara vitolorum merupakan parasit yang terdapat pada usus halus dari rumunansia, terutama kerbau dan sapi yang berumur 1-3 bulan. Morbilitas dan mortalitasnya cukup tinggi yang menyebabkan kerugian ekinomi cukup serius. T. vitulorum adalah parasit yang sangat penting pada sapi dan cukup mendapat perhatian masyarakat. Studi molekular terhadap parasit ini sangat penting untuk mengetahui karaktrisasinya. Tujuan penelitian ini untuk mempelajari karakterisasi dan identifikasi genom toksokara pada bagian internal transcribed spacer (ITS-1) dari larva T. vilorum. Penelitian ini diawali dengan mengisolasi genom larva. Amplifikasi DNA genom dilakukan dengan menggunakan polymerase chain reactions (PCR), dengan primer: 5’-TGCATAAGCACCATTTGCAC-3’ sebagai forward dan primer; 5’- AACGACAACGACACAACACG -3’ sebagai reverse. Hasil dari PCR diskuensing dengan menggunakan Big Dye terminator Mix through ABI 377A sequencer pada Laboratory of molecular biology. Studi karakter terhadap ITS-1 adalah tentang profil runutan ITS-1, dan homolog terhadap ITS-1 yang runutannya sama dengan ditemukan yang ada di Genebank. Runutan data ini telah dianalisis dengan menggunakan program MEGA Version 4. Kesimpulan yang dapat diambil, yaitu analisis penjajaran runutan ITS-1 T. vitolorum Kulonprogo sama dengan lima T.vitulorum lainya yang temukan dari Genbank, Studi molecular ini dapat membuktikan tentang identifikasi molekular T. vitolorum.
Toxocara vitulorum is a parasite of the small intestine of ruminants, particularly buffalo and calves of 1–3 months. It is responsable for high morbidity.and mortality rates resulting in serious economic losses. T. vitulorum is important parasite of calves with public concern. Molecular study of the parasite is very important to know its characters. The objectives of present study are to identify the characters of the partial genome of internal transcribed spacer (ITS-1) of Toxocara of the larvae of T. vitulorum . The research was started by genome isolation of the larvae. A polymerase chain reactions (PCR) was carried out to amplify the fragment genome of ITS-1, using 5’- TGCATAAGCACCATTTGCAC-3’ as forward primer; 5’- AACGACAACGACACAACACG -3’ as reverse primer. The PCR product was sequenced using Big Dye terminator Mix through ABI 377A sequencer in a Laboratory of molecular biology. The ITS-1 characters studied are the profile of ITS-1 sequence, the proportion nucleotides of the sequence and the homology of the ITS-1 with other sequences found in the Genebank. Sequence data was analyzed using MEGA program Version 4.the analyzed sequence alignment of ITS-1 of T.vitulorum Kulonprogo revealed that it was more similar with other five T.vitulorum which were obtained from Genbank .this study has provided useful molecular marker for the molecular identification of T.vitulorum .
Kata Kunci : Toxocara vitulorum;, calve cattle, ITS-1; rDNA