ISOLASI, SELEKSI, DAN IDENTIFIKASI BAKTERI ASAM LAKTAT SEKUM DOMBA UNTUK MITIGASI PRODUKSI METAN DALAM RUMEN

FATMA AINI LUBERINA, Prof. Ir. Zaenal Bachrudin, M.Sc., Ph.D., IPU., ASEAN Eng.; Dr. Ir. Chusnul Hanim, M.Si., IPM., ASEAN Eng.

2024 | Tesis | S2 Ilmu Peternakan

Penelitian ini bertujuan untuk memperoleh strain Bakteri Asam Laktat (BAL) baru dan unggul yang merupakan hasil isolasi, seleksi, dan identifikasi dari sekum domba untuk mitigasi produksi metan dalam rumen. Penelitian ini terdiri dari dua tahap yaitu: Tahap I: Isolasi, seleksi dan identifikasi BAL asal sekum domba. Tahap II: Aplikasi isolat BAL yang diperoleh untuk mitigasi produksi metan melalui fermentasi rumen secara in vitro. Prosedur isolasi dilakukan secara anaerob dengan media MRS dan CaCo₃. Prosedur seleksi meliputi uji daya tumbuh pada pH rendah, uji daya hambat terhadap bakteri patogen, dan uji kinetika pertumbuhan bakteri. Prosedur identifikasi yaitu dengan pengecatan gram, uji katalase, dan identifikasi secara molekuler dengan menggunakan metode amplifikasi sekuens gen 16S rRNA menggunakan primer universal 27F (AGAGTTTGATCCTGGCTCAG) dan 1429 R (TAGGGTTACCTTGTTACGACTT). Isolat yang telah teridentifikasi kemudian diaplikasikan pada fermentasi secara in vitro dengan metode Theodorou untuk mengetahui pengaruhnya terhadap parameter fermentasi pada rumen. Hasil isolasi, seleksi dan identifikasi dianalisis secara deskriptif, sedangkan hasil fermentasi isolat yang diperoleh di rumen secara in vitro dianalisis menggunakan Rancangan Acak Lengkap (RAL) pola faktorial 5x2 dengan 3 ulangan, dimana terdapat 2 faktor perlakuan yaitu faktor pertama adalah level glukosa dengan 5 jenis level glukosa meliputi glukosa 0 Ks, 0,25 Ks, 0,5 Ks, 0,75 Ks, dan 1 Ks. Faktor kedua adalah perlakuan 2 jenis mikroba meliputi mikroba rumen 100?n mikroba rumen:BAL domba dengan perbandingan 50%:50%. Hasil penelitian isolasi diperoleh 36 isolat BAL. Hasil penelitian seleksi diperoleh 1 isolat unggul yaitu BAL D-33. Hasil identifikasi secara molekuler menggunakan gen 16s rRNA menunjukkan isolat BAL D-33 teridentifikasi sebagai Lactobacillus reuteri. Hasil penelitian pada fermentasi rumen secara in vitro menunjukan bahwa interaksi antar perlakuan isolate BAL D-33 dan dengan glukosa tidak berpengaruh nyata (P>0,05) derajat keasaman (pH) namun mempengaruhi secara nyata (P<0>L. reuteri, yang dapat diaplikasikan dalam fermentasi untuk menurunkan produksi metan.  

This research aims to obtain new strains of Lactic Acid Bacteria (LAB) to mitigate methane production in the rumen because of isolation, selection and identification from the cecum of sheep. This research consists of two parts, namely: Stage I: Isolation, selection and identification of LAB from the sheep cecum. Stage II: Application of the LAB isolate obtained to mitigate methane production through in vitro rumen fermentation. The isolation procedure was carried out anaerobically with MRS and CaCo3 media. The selection procedure includes a growth test at low pH medium, an inhibition test against pathogenic bacteria, and a bacterial growth kinetics analysis. The identification procedure is by gram staining, catalase test, and molecular identification procedure used the 16S rRNA gene sequence amplification method using universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1429 R (TAGGGTTACCTTGTTACGACTT). The identified isolate was then applied to in vitro fermentation using the Theodorou method to determine its effect on fermentation parameters in the rumen. The results of isolation, selection and identification were analyzed descriptively, while the results of in vitro fermentation were analyzed using a Completely Randomized Design (CRD) with a 5x2 factorial pattern with 3 replications, where there were 2 treatment factors, namely the first factor was glucose level, there are 5 types of glucose levels including glucose 0 Ks, 0.25 Ks, 0.5 Ks, 0.75 Ks, and 1 Ks. Two types of microbes type composition were also used including 100% rumen microbes and rumen microbes with sheep LAB in a ratio of 50%:50%. The results of the isolation research obtained 36 LAB isolates. The results of research on in vitro rumen fermentation showed that the interaction between treatments of BAL D-33 isolate and glucose had no significant effect (P>0.05) on the degree of acidity (pH) but had a significant effect (P<0> The conclusion that can be drawn from this research is that a LAB isolate was obtained to mitigate methane production in the rumen which was identified as L. reuteri, which can be applied in fermentation to reduce methane production in the rumen.

Kata Kunci : Bakteri asam laktat, Sekum domba, Mitigasi metan rumen