ANALISIS DAGING NON-HALAL DALAM BAKSO SAPI MENGGUNAKAN REAL-TIME POLYMERASE CHAIN REACTION DENGAN PRIMER SPESIFIK GEN D-LOOP MITOKONDRIA UNTUK AUTENTIKASI HALAL

Rien Larasati Arini, Prof. Dr. apt. Abdul Rohman, M.Si. ; Dr. apt. Rumiyati, M.Si.

2023 | Tesis | S2 Ilmu Farmasi

Indonesia memiliki komunitas Muslim terbesar di dunia. Berdasarkan Undang-Undang No. 33 tahun 2014 menyatakan bahwa semua produk yang beredar di Indonesia harus tersertifikasi halal. Bakso merupakan makanan yang populer di Indonesia tetapi sering dicampur dengan daging non-halal seperti babi dan celeng demi keuntungan ekonomi. Sehingga penelitian ini bertujuan untuk mengembangkan metode analisis dengan Real-time PCR dengan primer spesifik untuk analisis daging babi dan celeng dalam bakso sapi. Penelitian diawali dari perancangan primer spesifik untuk DNA daging babi, celeng, dan sapi menggunakan software IDT dilanjutkan dengan isolasi DNA, uji spesifisitas, linieritas, batas deteksi, efisiensi, dan keterulangan. Hasil penelitian menunjukkan bahwa primer D-Loop 539 (Forward: ACTAATCAGCCCA TGCTCAC, Reverse: TGACTGTGTTAGGGCCTTTG), D-Loop 409 (Forward: AGCCCATGCTCAC ACATAAC, Reverse: TGACTGTGTTAGGGCCTTTG), dan D-Loop 922 (Forward: ATTACCATGCCGCGTGAA, Reverse: GATGAGATGGCCCTGAA GAAA) yang telah dirancang secara berurutan mampu mengindentifikasi DNA babi, celeng, dan sapi pada daging segar dan bakso pada suhu penempelan optimum masing-masing 61,2; 60,6; dan 59,5oC. Primer D-loop 539, dapat mengamplifikasi DNA babi dan bakso babi dengan batas deteksi 0,1 ng dan CV 0,25%. Primer D-loop 409, mampu mengamplifikasi DNA celeng dan bakso celeng sebesar 1 ng dan 0,1 ng, dengan nilai CV 0,37?n 0,44%. Primer D-loop 922, dapat mengamplifikasi DNA daging sapi dan bakso sapi sebesar 1 ng, dengan nilai CV 0,20% untuk DNA daging sapi dan 0,22% untuk bakso sapi. Tiga primer telah memenuhi kriteria pengujian PCR dan dapat digunakan untuk analisis bakso dari 12 Kecamatan di Sleman-Yogyakarta. Hasilnya menunjukkan amplifikasi negatif terhadap babi dan celeng dengan primer D-Loop 539 dan 409, amplifikasi positif hanya terjadi pada sapi dengan primer D-Loop 922. Penelitian ini mendukung autentikasi kehalalan produk untuk mendukung UU No. 33 tahun 2014.

Indonesia has the largest Muslim community in the world. Based on Law no. 33 of 2014 states that all products circulating in Indonesia must be halal certified. Meatballs are a popular food in Indonesia but are often mixed with non-halal meats such as pork and wild boar for economic gain. So this study aims to develop an analytical method with Real-time PCR with a specific primer for the analysis of pork and wild boar meat in beef meatballs. The research was initiated by designing specific primers for pork, wild boar and beef DNA using IDT software, followed by DNA isolation, specificity, linearity, limit of detection, efficiency and repeatability tests. The results showed that the primers were D-Loop 539 (Forward: ACTAATCAGCCCATGCTCAC, Reverse: TGACTGTGTTAGGG CCTTG), D-Loop 409 (Forward: AGCCCATGCTCACACATAAC, Reverse: TGACTGTGTTAGGGGCCTTTG), and D-Loop 922 (Forward: ATTACCATGC CGTGAA, Reverse: GATGAGATGGCCCTGAAGAAA ) who have sequentially designed to identify pork, wild boar, and beef DNA in fresh meat and meatballs at the optimum sticking temperature of 61.2 respectively; 60.6; and 59.5oC. Primer D-loop 539, can amplify pork DNA and pork meatballs with a detection limit of 0.1 ng and a CV of 0.25%. Primer D-loop 409 was able to amplify wild boar and meatball DNA by 1 ng and 0.1 ng, with CV values of 0.37% and 0.44%. Primer D-loop 922, can amplify beef and beef meatball DNA by 1 ng, with a CV value of 0.20% for beef DNA and 0.22% for beef meatball. The three primers have passed the PCR test and can be used for meatball analysis from 12 sub-districts in Sleman-Yogyakarta. The results showed negative amplification for pigs and wild boars with primers D-Loop 539 and 409, positive amplification only occurred in cattle with primers D-Loop 922. This research supports product halal authentication to support Law no. 33 of 2014.

Kata Kunci : D-Loop Mitokondria, Real-time PCR, Halal, Adulterasi, Bakso.