Penggunaan Real-Time Polymerase Chain Reaction (RT-PCR) dengan Primer Spesifik D-Loop untuk Analisis Daging Anjing (Canis lupus familiaris) dalam Bakso Sapi untuk Autentikasi Halal
Asrilia Zahra Rosa, Prof. apt. Abdul Rohman, M.Si.; apt. Marlyn Diah Laksitorini, M.Sc., Ph.D.
2023 | Skripsi | FARMASI
Accurate authentication of meat in food products is important for consumers because many consumers are worried about the meat they consume, related to dietary, health, and halal issues. The halal mandatory certificates for Small and Micro Enterprises (SMEs) are carried out in stages and have been targeted by the Indonesian government until 2024. However, there are still many processed products that are not guaranteed to be halal, for instance beef meatballs. This research was conducted to develop an analytical method of Real-Time PCR and its specific primer in halal authentication of beef meatballs from the presence of contaminants or non halal components, dog meat (Canis lupus familiaris). DNA specific primers were designed using IDT software, then tested for specificity, linearity, limit of detection, efficiency, and repeatability. D-loop 1 set 5 primers (forward; CCATCAACCCTTGCTCGTAAT, reverse: AGTTATGGCCCTGAGGTAAGA) has a good specificity against dog mitochondrial DNA at an annealing temperature of 58.3 C. The RT-PCR method using D-loop 1 set 5 primers has been validated with the results 0.001 ng limit of detection, a correlation coefficient of 0.997, an amplification efficiency of 96.9%, and a coefficient of variation (CV) of 1.36. Seven samples of beef meatballs from SMEs in Yogyakarta were tested using the validated RT-PCR method and showed no contamination from dog meat.
Kata Kunci : Anjing, Real-Time PCR, Autentikasi daging, Halal