Teknik Penggunaan Polymerase Chain Reaction (PCR) dan Elektroforesis pada Deteksi Gen P30 untuk Diagnosa Toxoplasmosis

TRIO SATRIO TOMO P, drh. Dela Ria Nesti, M.Sc.

2021 | Tugas Akhir | D3 KESEHATAN HEWAN

Toxoplasma gondii merupakan protozoa penyebab toxoplasmosis, bersifat zoonosis serta memiliki prevalensi penyebaran yang cukup tinggi di Indonesia. Deteksi toxoplasma sudah banyak dilakukan di laboratorium dengan metode serologi berupa Enzym Linked Immunosorbend Assay (ELISA), Indirect Fluorescent Antibodi Ujit (IFA), Latex Agglutination Test (LAT) dan Haemagglutination Test namun metode ini masih memiliki kekurangan yaitu spesivitas rendah, tidak dapat membedakan infeksi laten atau tidak dan membutuhkan reagen yang terstandardisasi. Deteksi cepat dibutuhkan untuk mengurangi resiko penyebaran. Tugas akhir ini bertujuan untuk mengetahui prosedur dan teknik penggunaan PCR dan elektroforesis untuk deteksi gen P30 pada diagnosa toxoplasmosis. Primer gen P30 yang digunakan terdiri dari oligonukleotida primer 1: 5'CACACGGTTGTATGTCGGTTTCGCT3' dan oligonukleotida primer 2: 5'TCAAGGAGCTCAATGTTACACAGCCT3'. Sampel yang digunakan merupakan sampel darah yang telah diekstrasi DNA nya di BBVet Wates dari 10 ekor sapi yang dinyatakan positif mengandung parasit darah melalui pemeriksaan apus. Sampel berasal dari wilayah Kabupaten Kulon Progo. Prosedur PCR dilakukan melalui tahap pra denaturasi, denaturasi, annealing, elongasi, post ekstensi dan diakhiri netralisasi. Tahap PCR terus berulang sebanyak 40 siklus. Hasil amplifkasi dideteksi menggunakan elektroforesis gel agarosa dan diamati dengan UV transluminator. Hasil positif ditunjukkan pada panjang nukleotida 400 bp. Terdapat 4 (40 %) sampel positif serta 6 (60%) sampel negatif.

Toxoplasma gondii is protozoa that causes toxoplasmosis, zoonotic disease and has a high spread prevalence in Indonesia. Toxoplasma detection has been done in many laboratories with serological methods such as Enzym Linked Immunosorbend Assay (ELISA), Indirect Fluorescent Antibody Test (IFA), Latex Agglutination Test (LAT) and Haemagglutination Test, but those method still low in specificity and unable to differentiate between latent infections, and requires standardized reagents. Rapid detection is required to reduce the risk of disease distribution. This final project aims to determine the procedures and techniques for using PCR and electrophoresis to detect the P30 gene in toxoplasmosis diagnosis. The P30 gene primers used consisted of primary oligonucleotide 1: 5'CACACGGTTGTATGTCGGTTTCGCT3' and primary oligonucleotide 2: 5'TCAAGGAGCTCAATGTTACACAGCCT3'. The sample used was a blood sample that had DNA extracted at BBVet Wates from 10 cows that positive for blood parasites through blood smear examination. The samples collected from the Kulon Progo district. The PCR procedure is carried out through the stages of pre-denaturation, denaturation, annealing, elongation, post extension and ending with neutralization. Stage of PCR was repeated for 40 cycles. The amplification results were detected using agarose gel electrophoresis and observed with a UV transluminator. Positive results were showed 400 bp of nucleotides length. There were 4 (40%) positive samples and 6 (60%) negative samples.

Kata Kunci : Toxoplasma gondii, Gen P30, PCR, Elektroforesis/ Toxoplasma gondii, P30 Gene, PCR, Electrophoresis