Pengembangan Nucleic Acid Lateral Flow (NALF) untuk Deteksi dan Penentuan Serotipe Virus Dengue

NARENDRA YOGA H, Prof. dr. Tri Wibawa, Ph.D., Sp.MK(K).; Dr. drh. Asmarani Kusumawati, M.P.; dr. Abu Tholib Aman, M.Sc., Ph.D., Sp.MK(K).

2019 | Disertasi | DOKTOR BIOTEKNOLOGI

Demam dengue adalah penyakit infeksi disebabkan oleh virus Dengue (DENV) yang memiliki 4 serotipe (DENV1-4). Infeksi virus menyebabkan penyakit dengan tingkat ringan hingga sangat parah yang menimbulkan kematian jika terlambat ditangani. Penelitian bertujuan membuat alat konfirmasi hasil amplifikasi RNA untuk deteksi dan penentuan serotipe DENV menggunakan metode Nucleic Acid Lateral Flow (NALF) yang digunakan pada awal infeksi penyakit. Pembuatan NALF diawali kajian genom virus untuk merancang sekuen probe capture spesifik serotipe untuk keempat serotipe DENV. Dipstik DEN-NALF dibuat secara fabrikasi di Laboratorium Hepatika Mataram, kemudian diuji dengan beberapa analisis seperti pengaruh dari jenis dapar, volume dapar, suhu dapar, waktu hibridisasi terhadap reaksi hibridisasi DEN-NALF. Uji spesifisitas analitis menggunakan target amplikon ssDNA sintetik keempat serotipe. Ambang batas deteksi menggunakan serial pengenceran dua kali. Hasil reaksi hibridisasi pada test line diukur intensitas warna dengan Image J, hibridisasi silang dilihat secara visual, dan uji pengaruh tiap variabel dengan statistik ANOVA satu arah. Kajian genome diperoleh susunan probe capture yang berdekatan yaitu untuk DENV1 CACCAGGGGAAGCTGTACCCTGGTGGT, DENV2 GGTGAGATGAAGCTGTAGTCTCACTGG, DENV3 GCACTGAGGGAAGCTGTACCTCCTTGCA, DENV4 AGCCAGGAGGAAGCTGTACTTCTGGTGG. Analisis pengaruh jenis larutan dapar diperoleh jenis dapar yang tidak menyebabkan terjadi hibridisasi silang dengan sinyal warna tinggi yaitu berbasis PBS 0,5X dengan tambahan gliserol. Volume larutan diuji volume 40, 60, 80, 100, dan 120 uL memberikan sinyal tertinggi pada volume 100 uL (100%). Suhu larutan dapar diuji pada suhu 4, 27, 37, dan 42C. Suhu rendah 4C sinyal telah muncul 59% dan suhu 42C memberikan sinyal tertinggi 100% sedangkan suhu ruangan memberikan sinyal warna 81%. Analisis lama waktu hibridisasi diuji pada waktu menit ke-50, 60, 70, 80, 90, 100, 110, dan 120. Sinyal warna mulai muncul mulai menit ke-70 (39%) dan optimal pada menit ke 100 (97%). Hasil analisis uji ambang batas deteksi untuk probe capture DENV1 adalah 6,25 uM dan untuk DENV1, DENV2, dan DENV4 adalah 390 nM. Uji spesifisitas memberikan hasil tidak muncul sinyal warna pada test line bukan target pada semua konsentrasi pengenceran. Metode NAFL yang dikembangkan memiliki spesifisitas analitis yang baik membedakan keempat serotipe DENV. Ambang batas deteksi diperoleh tinggi untuk DENV2-4 tetapi masih rendah untuk DENV1.Semua variabel yang diteliti yang mempengaruhi reaksi hibrididisasi DEN-NALF. Jenis dapar, volume dapar, suhu kerja dapar, dan lama waktu hibridisasi mempengaruhi hasil reaksi hibridisasi dimana yang memberikan hasil nyata (p<0,05) yaitu volume dapar mulai 60 uL dan lama waktu mulai 80 menit sedangkan suhu dapar tidak menunjukan pengaruh yang kuat (p>0,05) pada variabel yang diuji.

Dengue fever is one of infectious disease caused by four serotype of dengue virus (DENV 1-4). Virus infection cause fever from mild to severe that cause death if late treatment. Study aim was develop a tool to cornfirmation RNA amplification for detecting and serotyping DENV use Nucleid Acid Lateral Flow (NALF) method for early infection. Developing NALF was begun with study of DENV genome to design specific capture probe for DEN-NALF sequence of each DENV serotype. DEN-NALF fabricated at Hepatika Laboratory Mataram. Then it was tested with several analysis of effects toward hybridization reaction i.e. buffer composition, buffer volume, temperature reaction, and hybridization time. The synthetic amplicon of ssDNA DENV1 was used to test threshold hybridization and specify of four DENV serotypes with 2 fold dilutions. Result of hybridization reaction on colour signal quantified using ImageJ software, cross hybridization by visual inspection, and affects each variable testing using statiscally ANOVA one way. Study analysis of DENV genome obtained adjacent sequence of specific capture probe for DENV1, DENV2, DENV3, and DENV4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GGTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, and AGCCAGGAGGAAGCTGTACTTCTGGTGG respectively. Analyses of buffer effect gave composition with PBS 0.5X and glycerol addition showed no cross hybridization and highest peak in Image J analysis. Buffer volumes were tested at volume of 40, 60, 80, 100, dan 120 uL and showed signal at minimal volume of 60 uL which gave 59% signal from highest of 100 uL (100%). Temperature effects were tested at 4, 27, 37, and 42 degree celcius. Temperature at 4C has worked, given colour signal 59% from those the highest 100% at 42C which at room temperature gave 81% colour signal. Hybridization time reaction used 50, 60, 70, 80, 90, 100, 110, and 120 minutes variation. Signal appeared in 70 minutes (39% signal) and went up until optimized in 100 minutes (97% signal). Limit of detection analysis showed minimum concentration of specific probe capture DENV1 was 6.25 uM and DENV2, DENV3, and DENV4 were 390 nM. Analitical specificity test showed no color signal on non-target test line at all sample consentration. Dipstick of NAFL had high analitycal specificity to determine four different serotypes of DENV. Limit of detection of DENV2-4 were high but DENV1 was low. All of study variables i.e. buffer composition, buffer volume, temperature reaction, and hybridization time gave effect toward hybridization reaction of DEN-NALF which significant (p<0.05) start at volume of 60 uL and 80 minutes but showed no significant effect (p>0.05) on each temperature variable.

Kata Kunci : serotipe DENV, NALF, spesifisitas analitis, ambang batas deteksi