Biosistematika Bazzania Gray (Lepidoziaceae) Berdasarkan Karakter Morfologis, Anatomis dan Molekular

LILIH KHOTIMPERWATI, Rina Sri Kasiamdari, S.Si. Ph.D.; Prof(emr). Dr. Santosa; Dr. Budi Setiadi Daryono, M.Agr.Sc.

2019 | Disertasi | DOKTOR BIOLOGI

Bazzania mempunyai jumlah spesies terbanyak pada suku Lepidoziaceae. Identifikasi dan penetuan batasan di tingkat spesies kadang mengalami kesulitan karena luasnya variasi morfologis. Keragaman spesies dan data taksonomis Bazzania di Jawa Tengah masih sedikit. Penelitian ini bertujuan mengkaji variasi, keragaman spesies dan hubungan kekerabatan berdasarkan karakter morfologis-anatomis, penanda molekular ISSR dan sekuen DNA daerah trnL-F. Sampel penelitian berasal dari Gunung Lawu, Gunung Ungaran dan Gunung Slamet Jawa Tengah. Pengumpulan spesimen dilakukan dengan metode jelajah. Karakterisasi dan identifikasi spesies berdasarkan pustaka yang berisi kunci identifikasi, deskripsi dan ilustrasi Bazzania. Isolasi DNA genom mengikuti metode CTAB yang dimodifikasi. Primer untuk amplifikasi DNA ISSR: IS-807, IS-810, IS-834 dan IS-881. Amplifikasi DNA daerah trnL-F menggunakan primer c [5'CGAAATCGGTAGACGCTACG3'] sebagai primer forward dan primer f [5'ATTTGAACTGGTGACACGAG3'] sebagai primer reverse. Identifikasi 44 sampel berdasarkan karakter morfologis dan anatomis diketahui sebanyak 11 spesies, yaitu B. calcarata, B. fauriana, B. japonica, B. javanica, B. pectinata, B. perfalcata, B. praerupta, B. serpentina, B. spiralis, B. succulenta dan B. tridens. B. fauriana, B. perfalcata, dan B. succulenta merupakan catatan baru spesies Bazzania (new record species) di Pulau Jawa. Karakter morfologis, anatomis, penanda ISSR dan sekuen DNA daerah trnL-F dapat digunakan untuk pengelompokan dan pemisahan spesies Bazzania di Jawa Tengah. Hubungan kekerabatan berdasarkan morfologisâ dan anatomis pada tingkat spesies mempunyai koefisien similaritas berkisar 0,81-1,00, berdasar penanda ISSR pada tingkat spesies koefisien similaritas berkisar 0,71-0,96, sedangkan berdasar sekuen DNA daerah trnL-F mempunyai kisaran jarak genetik intraspesies 0,000-0,0375 dan interspesies 0,0046-0,0655. Hasil analisis hubungan kekerabatan berdasarkan karakter morfologis-anatomis, penanda ISSR dan sekuen DNA daerah trnL-F menunjukkan bahwa pengelompokan sampel Bazzania berdasarkan kesamaan spesiesnya. Populasi Bazzania di Jawa Tengah mempunyai variaisi genetik yang tinggi dengan nilai heterozigositas total (HT) sebesar 0,334. Tingginya variasi genetik juga tercermin dari banyaknya mutasi pada sekuen DNA trnL-F di daerah intron.

Bazzania has the most species among Lepidoziaceae family. As the result, it is difficult to identify and determine the boundaries at each species level due to the wide range of morphological variations. There is still a few data about the diversity of species and taxonomic data of Bazzania in Central Java. This research aimed to examine the variation, the species diversity and the relationship based on morphological-anatomical characters, molecular markers of ISSR and DNA sequences of trnL-F regions. The samples of the research were collected from Mount Lawu, Mount Ungaran, and Mount Slamet in Central Java. The plotless analysis method was used to collect the specimens. The characterization and identification of the specimens were based on some references containing the identification keys, descriptions and illustrations of Bazzania. The isolation of genomic DNA followed the modified CTAB method. The primers for ISSR DNA amplification were: IS-807, IS-810, IS-834 and IS-881. The DNA amplification of the trnL-F region used primer c [5'CGAAATCGGTAGACGCTACG3'] as the forward primer and f [5'ATTTGAACTGGTGACACGAG3'] primer as the reverse primer. The identification of the 44 samples based on morphological and anatomical characters discovers 11 species, they are B. calcarata, B. fauriana, B. japonica, B. javanica, B. pectinata, B. perfalcata, B. praerupta, B. serpentina, B. spiralis, B. succulenta and B. tridens. B. fauriana, B. perfalcata, and B. succulenta were found as the new records of the Bazzania species in Java. The morphological- anatomical characters, the ISSR markers and DNA sequences of trnL-F region can be used to classify and separate some species of Bazzania in Central Java. The relationship based on morphological-anatomical chaeacters at species categories had similarity coefficients ranged betwen 0.81 and 1.00, while by ISSR marker had range betwen 0.71 and 0.96. The genetic distance of intraspecies and interspecies based on DNA sequence of trnL-F were 0.000-0.0375 and 0.0046-0.0655 respectively. The result of the analysis of raltionship based on the morphological-anatomical characters, the ISSR markers and the DNA sequences of trnL-F indicated that the clustering of Bazzania samples was not determined by the similarity of the species. Bazzania population in Central Java had high genetic variations with the high total value of heterozygosity (HT) of 0.334. The high genetic variation was also shown in the large number of mutations in the trnL-F DNA sequence in the introns.

Kata Kunci : Kata kunci: Bazzania, variasi genetik, hubungangan kekerabatan, ISSR, trnL-F, Java