DETEKSI Verocytotoxygenic Escherichia coli (VTEC) ASAL SUSU DAN LINGKUNGAN SAPI PERAH YANG DIINOKULASI PADA BRILLIANT GREEN LACTOSE BILEBROTH (BGLB) MENGGUNAKAN POLYMERASE CHAIN REACTION (PCR)

WINDA AYUNINGTYAS, Dr. drh. Yatri Drastini, M.Sc.

2019 | Tesis | MAGISTER SAINS VETERINER

Bakteri Verocytotoxygenic Escherichia coli (VTEC) merupakan bakteri patogen yang dapat dijumpai pada susu dan lingkungan sapi perah. Bakteri VTEC termasuk bakteri Coliform yang memfermentasi laktosa, sehingga dapat ditumbuhkan pada Brilliant Green Lactose BileBroth (BGLB). Selama ini isolasi VTEC dilakukan dengan media pengaya BGLB, kemudian Eosin Methylene Blue (EMB) (media spesifik Escherichia coli), dan Sorbitol MacConkey (SMAC) (media spesifik VTEC O157:H7), sehingga membutuhkan biaya dan waktu yang tidak sedikit. Penelitian ini bertujuan untuk deteksi VTEC pada isolat bakteri dalam BGLB menggunakan PCR. Sampel berasal dari susu dan lingkungan sapi perah. Sampel berjumlah 9 sampel, terdiri dari isolat VTEC O157:H7 sebagai kontrol positif (1), susu dari cooling unit (3), swab tangan setelah pemerahan (1), swab saringan susu (1), tinja (1), air dari tempat minum (1), dan swab tangan sebelum pemerahan (1). Metode penelitian dilakukan dengan cara sampel diinokulasi pada media pengaya BGLB, kemudian DNA diekstraksi menggunakan kit, dan dilakukan PCR dengan primer spesifik untuk mendeteksi VTEC. Primer spesifik berupa vt1 forward (5 aksen CAGTTAATGTGGTGGCGAAG 3 aksen) dan vt1 reverse (5 aksen CTGCTAATAGTTCTGCGC ATC 3 aksen) dengan produk amplifikasi sebesar 130 bp, serta vt2 forward (5 aksen CCATGACAACGGACAGCAGTT 3 aksen) dan vt2 reverse (5 aksen CCTGTCAACTGAGCAC TTTG 3 aksen) dengan produk amplifikasi sebesar 779 bp. Hasil PCR yang telah dielektroforesis diamati di UV Transluminator. Hasil positif VTEC disekuensing dan dianalisis dengan menggunakan BLAST. Semua sampel menunjukkan hasil positif pada media BGLB. Hasil PCR menggunakan primer vt1 menunjukkan kontrol positif dan swab tangan sebelum pemerahan positif. Hasil sekuensing menggunakan primer vt1 menunjukkan swab tangan sebelum pemerahan positif VTEC. Hasil PCR menggunakan primer vt2 menunjukkan kontrol positif dan tinja positif. Hasil sekuensing menggunakan primer vt2 menunjukkan kontrol positif terdeteksi VTEC O157:H7dan tinja bukan VTEC O157:H7.

The Verocytotoxigenic Escherichia coli (VTEC) bacterium is a pathogenic bacterium found in milk and dairy cow environments. The bacteria is included Coliform bacteria fermenting lactose, so that they can be grown on Brilliant Green Lactose BileBroth (BGLB). So far VTEC isolation is carried out with BGLB enrichment media, Eosin Methylene Blue (EMB) (Escherichia coli specific media), and Sorbitol MacConkey (SMAC) (VTEC O157: H7 specific media) so that it requires a lot of money and time. This study aimed to detect VTEC in bacterial isolates in BGLB using PCR. The samples came from milk and the dairy cow environments. The samples were 9 consisting of isolate VTEC O157:H7 as positive control (1), milk from the cooling unit (3), a hand swab after milking (1), a milk filter swab (1), feces (1), drinking water (1), and a hand swab before milking (1). The research method was as followed. The samples were inoculated in BGLB (enrichment media), DNA was extracted using DNA kits, and PCR was performed with the specific primers to detect VTEC. The specific primers were vt1 forward (5 aksen CAGTTAATGTGG TGGGCGAAG 3 aksen) and vt1 reverse (5 aksen CTGCTAATAGTTCTGCGCATC 3 aksen) with an amplification product of 130 bp , and vt2 forward (5 aksen CCATGACAACGGACAGCAGTT 3 aksen) and vt2 reverse (5 aksen CCTGTCAACTGAGCACTTTG 3 aksen) with an amplification product of 779 bp. The PCR results which had been electrophoresed were observed in UV Transluminator. Positive VTEC results were sequenced and analyzed used BLAST. All samples showed positive results in BGLB. The PCR results with vt1 primers showed the positive control and hand swab before milking were positive. The sequencing results with vt1 primers showed hand swab before milking was positive VTEC. The PCR results with vt2 primers showed the positive control and feces were positive. The sequencing results with vt2 primers showed the positive control was VTEC O157:H7 and feces was not VTEC O157:H7.

Kata Kunci : VTEC, sapi perah, BGLB, PCR, primer vt1 dan vt2