UJI SENSITIVITAS Trypanosoma evansi DENGAN PEMBERIAN OBAT ISOMETAMIDIUM KLORIDA SECARA IN VIVO PADA MENCIT (Mus musculus) DAN DETEKSI MOLEKULER GEN PENYANDI KELUARGA PROTEIN ATP BINDING CASSETTE (ABC) TRANSPORTER
MOH. MIRZA NURYADY, Dr. drh. Rini Widayanti
2019 | Tesis | MAGISTER SAINS VETERINERTrypanosoma evansi merupakan parasit darah penyebab penyakit surra dan ditetapkan sebagai salah satu penyakit hewan menular strategis. Kasus resistensi obat adalah salah satu masalah dalam pengendalian dan penanganan surra. Penelitian ini bertujuan untuk mengevaluasi pemberian obat Isometamidium Klorida pada Trypanosoma evansi dengan tes in vivo pada mencit dan mengetahui sekuen keluarga Protein ABC Transporter. Mencit berjumlah 20 ekor, strain BALB/c, jantan, umur 2 bulan, berat badan ± 30 gram, diperoleh dari Laboratorium Pengujian dan Penelitian Terpadu (LPPT) UGM, diadaptasikan selama satu minggu. Mencit dibagi menjadi 4 kelompok terdiri dari 5 ekor perkelompok perlakuan, yaitu Kelompok kontrol (aquades), Kelompok 1 dengan dosis ISMM 1.5 mg/kg, Kelompok 2 dengan dosis 3 mg/kg, Kelompok 3 dengan dosis 9 mg/kg. Setiap mencit diinfeksi 105 Trypanosoma evansi secara intraperitonial. Pengobatan diberikan ketika mencit telah mencapai tingkat parasitemia ± 108 Trypanosoma/mL darah, hal ini diprediksi terjadi 24 jam pasca infeksi. Pengamatan parasitemia dilakukan setiap hari selama 30 hari. Metode pemeriksaan dengan Wet Blood Film (WBF), apabila hasilnya negatif dilanjutkan dengan pemeriksaan Microhaematocrit (MHCT). Data yang diperoleh dari kelompok perlakuan adalah tingkat parasitemia, jumlah kematian dan mencit hidup dari masing-masing dosis uji, data dianalisis menggunakan standar probit. Isolasi genom Trypanosoma evansi dilakukan dengan mengambil darah mencit (parasitemia 108) 200µl dan diekstraksi menggunakan KIT DNAeasy, Qiagen. Dilakukan amplifikasi gen target dengan metode Polimerase Chain Reaction (PCR) menggunakan 2 pasang primer, F1 5'CCTCACTTTGTGGCCGTATAA3', primer R1 5'ATCCACAGCCTCCGTATTCTT3'; primer F2 5'AGATGAGT GATCAAGACTGGAAA3',primer R2 5'ACCGGTTATACCACCATTA CTTT3' dan selanjutnya hasil PCR disekuensing dan dianalisis menggunakan Mega Software. Hasil penelitian menunjukkan dosis ISMM 1.5 mg/kgBB dan 3 mg/kgBB tidak efektif dalam penyembuhan hewan yang terinfeksi, sedangkan dosis 9 mg/kgBB didapatkan 20% mencit berhasil sembuh. Gen yang didapatkan dalah gen Multri Drug Resistance Protein (MRP) A dan E yang termasuk keluarga ABC transporter, dengan fungsi utama adalah expor obat. Dari penelitian ini dapat disimpukan bahwa penggunaan range dosis obat ISMM 1.5, 3 dan 9 mg/kgBB tidak efektif untuk T. evansi isolat ngawi dan gen MRP yang didapatkan bersifat konservatif di seluruh tingkatan spesies.
Trypanosoma evansi is a blood parasite that causes surra and was designated as one of the strategic infectious diseases. One of the problems in controlling and handling surra is a case of drug resistance. This study aimed to evaluate the administration of Isometamidium Chloride drug in Trypanosoma evansi with an in vivo test in mice and continued sequencing of the ABC Transporter Protein family gene. Total 20 mice, BALB / c strains, male, aged 2 months, body weight ± 30 grams, obtained from the UGM - LPPT, and adapted for one week. Mice were divided into 4 groups consisting of 5 treatment groups. Each mouse was infected intraperitonially 105 Trypanosoma evansi. Treatment is given when the mice have reached the level of parasitemia ± 108 - 109 Trypanosoma / mL blood, this is predicted to occur 24 hours after the artificial infection. Provision of drugs at a dose of 1.5 mg / kgBW, 3 mg / kgBW, 9 mg / kg BW and distilled water (control). Observation of parasitemia is carried out every day for 30 days of observation. The examination method used was Wet Blood Film (WBF), if the results were negative it would be followed by a Microhaematocrit centrifugation Technique (MHCT) examination. Data obtained from the treatment group were the level of parasitemia, the number of deaths and the number of live mice from each test dose. Data were analyzed using standard probit analyzes. The next step is the isolation of the genome of Trypanosoma evansi by taking the blood of mice (parasitemia 108 - 109) 200µl and DNA extraction using KIT DNAeasy, Qiagen. Propagation of target genes was carried out using the Polymerase Chain Reaction (PCR) method and then the PCR results were sent to PT. Genetika Science for sequencing and results will be analyzed using Mega Software. The results showed that the dose of ISMM 1.5 mg / kgBB and 3 mg / kgBB was less effective in healing infected animals, whereas a dose of 9 mg / kg was obtained 20% of mice recovered and 80% of mice collapsed after drug injection. The gene obtained is the Multri Drug Resistance Protein (MRP) A and E gene which belongs to the ABC transporter family, with the main function being the export of drugs from the cell to the environment. From this study it can be concluded that range of ISMM doses 1.5, 3 and 9 mg / kgBB drug doses is not effective for T. evansi Ngawi isolates and MRP genes obtained are conservative at all species levels.
Kata Kunci : Isometamidium Klorida, Trypanosoma evansi, resistance, ABC Transporter, Multi Drug Resistance Protein