IDENTIFIKASI MORFOLOGI DAN MOLEKULER NEMATODA PADA GAJAH SUMATERA (Elephas maximus sumatranus) DI TAMAN NASIONAL WAY KAMBAS

RAHMANIA PRAHARDANI, Dr. drh. R. Wisnu Nurcahyo; Dr. drh. Yanuartono, M.P.

2018 | Tesis | MAGISTER SAINS VETERINER

Identifikasi parasit penting kaitannya dalam mengetahui kekerabatan antar spesies yang berhubungan dengan siklus hidup yang sama. Hal tersebut penting dilakukan untuk mengendalikan keberadaan cacing. Penelitian ini bertujuan untuk mengidentifikasi nematoda dewasa secara morfologi dan molekuler serta untuk mengetahui ultrastruktur permukaan nematoda dewasa pada gajah Sumatera di kawasan Taman Nasional Way Kambas. Sampel yang digunakan dalam penelitian ini adalah nematoda dewasa yang diambil dari feses dua ekor gajah Sumatera di kawasan Taman Nasional Way Kambas setelah diberikan Albendazole dosis 10 mg/kg BB. Sampel yang digunakan dalam identifikasi morfologi berjumlah 60 ekor cacing. Identifikasi morfologi dilakukan dengan pemeriksaan dan pengukuran pada mikroskop yang dilengkapi dengan kamera. Pemeriksaan ultrastruktur permukaan nematoda dewasa menggunakan Scanning Electron Microscope (SEM). Sampel yang digunakan dalam identifikasi molekuler berjumlah dua ekor cacing dari dua ekor gajah Sumatera. Identifikasi molekuler dilakukan dengan teknik Polymerase Chain Reaction (PCR) menggunakan primer Internal Transcribed Spacer (ITS)1, 5.8S, ITS2 forward GTAGGTGAACCTGCGGAAGGATCATT dan reverse TTAGTTTCTTTTCCTCCGCT dilanjutkan dengan sekuensing. Hasil identifikasi nematoda dewasa secara morfologi dan molekuler dianalisa secara deskriptif. Hasil identifikasi morfologi berdasarkan ukuran panjang cacing jantan dan betina, bentuk dan jumlah eksternal leaf crown, bentuk bursa kopulatrik, panjang dorsal ray, panjang spikulum, letak vulva, dan panjang ekor cacing betina diduga merupakan Quilonia travancra. Hasil PCR menunjukkan band yang jelas dan menghasilkan panjang basa yang sama yaitu 823 bp. Alignment hasil sekuen dianalisis menggunakan Basic Local Alignment Search Tool (BLAST) menunjukkan bahwa kedua sampel nematoda identik 81% dengan Quilona africana (JN252691.1) yang terdaftar di GeneBank. Data sekuen nukleotida diolah lebih lanjut menggunakan software Molecular Evolutionary Genetics Analysis (MEGA) 5 yang menunjukkan tidak ada perbedaan nukleotida diantara kedua sampel nematoda gajah Sumatera namun memiliki perbedaan 111 nukleotida dengan Quilona africana (JN252691.1). Nilai jarak genetik antara kedua sampel nematoda sebesar 0% dan 16,9 % dengan Quilona africana (JN252691.1). Konstruksi pohon filogenetik menunjukkan bahwa kedua sampel nematoda memiliki kekerabatan terdekat dengan Quilona africana (JN252691.1) dengan nilai bootsrap 80%.

Parasit identification is important in relation to know the relationships between species that related to the same life cycle. This is important to control the presence of worms. This study aims to identify morphological and molecular adult nematodes as well as to determine the ultrastructure adult nematodes on Sumatran elephants in Way Kambas National Park region. The sample used in this study were adult nematodes taken from the feces of two Sumatran elephants in the Way Kambas National Park after 10 mg/kg BW Albendazole was given. The sample used in the identification of morphology were 60 worms. Morphological identification was carried out by examination and measurement on a microscope equipped with a camera. Ultrastructure observation on the surface of adult nematodes used Scanning Electron Microscope (SEM). The samples used in the molecular identification were two worms from two Sumatran elephants. Molecular identification was performed by Polymerase Chain Reaction (PCR) technique using Internal Transcribed Spacer (ITS)1, 5.8S, ITS2 forward primer GTAGGTGAACCTGCGGAAGGATCATT and reverse TTAGTTTCTTTTCCTCCGCT continued by sequencing. Result of the morphological and molecular identification were analyzed descriptively. The result of the morphological identification were based on the size of male and female worms, the shape and number of external leaf crowns, the shape of the male bursa, the length of the dorsal ray, the length of the spicules, the location of the vulva, and the female worm's tail was thought to be Quilonia travancra. The result of PCR showed a clear band and produced the same base length which is 823 bp. Alignment of sequence results were analyzed using the Basic Local Alignment Search Tool (BLAST) indicating that the two nematode samples were identical 81% with Quilona africana (JN252691.1) in GeneBank. The sequence of nucleotide data were further processed using Molecular Evolutionary Genetics Analysis (MEGA) 5 software which showed no nucleotide differences between the two nematode samples of Sumatran elephant but had 111 nucleotides with Quilona africana (JN252691.1). Genetic distance values between the two nematode samples were 0% and 16.9% with Quilona africana (JN252691.1). The construction of phylogenetic tree showed that both nematode samples had the closest kinship with Quilona africana (JN252691.1) with 80% bootsrap value.

Kata Kunci : Gajah Sumatera (Elephas maximus sumatranus), molekuler, morfologi, Quilonia africana, Quilonia travancra