Real-Time Polymerase Chain Reaction (Real-Time PCR) Dengan Primer Spesifik Gen D-Loop DNA dan Sekuensing Untuk Identifikasi Cemaran Daging Monyet Dalam Bakso Sapi

DWIKY RAMADHANI K, Prof. Dr. Sismindari, S.U., Apt; Prof. Dr. Abdul Rohman, M.Sc., Apt

2018 | Tesis | MAGISTER ILMU FARMASI

Daging monyet ekor panjang (Macaca fascicularis) merupakan daging yang tidak halal untuk dikonsumsi oleh warga Muslim dan terdapat temuan yang menggunakan daging monyet sebagai campuran dalam bakso di Indonesia. Hal tersebut memicu peneliti untuk mengembangkan metode berbasis DNA yang secara spesifik mampu mendeteksi adanya cemaran daging monyet dalam makanan yaitu real-time Polymerase Chain Reaction (real-time PCR). Tujuan penelitian ini adalah untuk mengembangkan teknik deteksi real-time PCR yang dikombinasikan dengan primer spesifik-monyet dalam identifikasi spesies daging dalam bakso untuk antisipasi sekiranya ada daging monyet di dalamnya. Real-time PCR diaplikasikan dengan menggunakan primer F4:TGACTCCCACCACATCCC dan R4:GTGTGGAGCTAGAATATTGAA-CCG yang spesifik mengamplifikasi gen D-loop mitokondria DNA (mtDNA) monyet namun tidak mengamplifikasi DNA sapi, babi, celeng, kambing, ayam, dan anjing. Melting Curve Analysis (MCA) digunakan untuk untuk membuktikan spesifitas amplikon. Primer tersebut terbukti spesifik ditandai dengan munculnya satu puncak suhu lebur pada MCA yaitu 79,0�°C pada spesies M. fascicularis. Produk real-time PCR spesies M. fascicularis dikonfirmasi urutan basanya menggunakan AB Genetic Analyzer. Hasil pensejajaran sekuen amplikon dengan gen D-loop mtDNA M. fascicularis (FJ906803.1) menghasilkan persentase kemiripan 96.88% yang berarti primer F4 dan R4 spesifik mengamplifikasi basa pada urutan 98-195. Metode real-time PCR dengan primer F4 dan R4 menghasilkan efisiensi (E) 73.3% dan 71.1% masing-masing untuk DNA monyet murni dan bakso monyet 100% dengan batas deteksi 0.0078 ng (daging monyet) dan 1% (w/w) (bakso biner (monyet-sapi). Metode ini terbukti presisi untuk mendeteksi adanya DNA daging monyet dengan RSD yaitu 0.55%; 0.86%; dan 1.81%. Metode real-time PCR dengan primer D-loop F4 dan R4 ini tidak mendeteksi adanya DNA daging monyet dalam 12 bakso pasaran di Yogyakarta. Berdasarkan hasil tersebut, disimpulkan bahwa metode real-time PCR dengan primer F4 dan R4 dapat digunakan sebagai alat yang reliable dan akurat untuk mengidentifikasi adanya cemaran daging monyet dalam bakso.

Long-tailed monkey meat (Macaca fascicularis) is a meat that is not halal to be consumed by Muslims and there are proves that use monkey meat as a mixture in meatballs in Indonesia. This issue led researchers to develop DNA-based methods that were specifically able to detect the presence of contaminated monkey meat in foods one of which is real-time Polymerase Chain Reaction (real-time PCR). The purpose of this study was to develop a real-time PCR determination technique combined with a monkey-specific primer in the identification species of meat in meatballs to anticipate if there were monkey meat in it. Real-time PCR was applied using primers F4: TGACTCCCA-CCACATCCC and R4:GTGTGGAGCTAGAATATTGAACCG amplify specifically mitochondrial D-loop DNA (mtDNA) genes of monkeys but not amplify DNA of cattle, pigs, wild boars, goats, chickens, and dogs. Melting Curve Analysis (MCA) is used to prove the specificity of the amplicon. The specific primer is characterized by the appearance of a peak of melting temperature at 79,0�°C in M. Fascicularis species. The PCR real-time product of the M. Fascicularis species confirmed its sequence using AB Genetic Analyzer. The alignment of the amplicon sequence with the M. Fascicularis mtDNA D-loop gene (FJ906803.1) resulted in a 96.88% similarity percentage, which means that the F4 and R4 primers amplify specifically at 98-195 of M. Fascicularis mtDNA D-loop . The real-time PCR method with primers F4 and R4 yielded efficiency (E) 73.3% and 71.1% respectively for pure monkey DNA and 100% monkey meatballs with detection limit of 0.0078 ng (monkey meat) and 1% (w / w) biner-meatballs (monkey-beef). This method proved precision to detect the presence of DNA of monkey meat with RSD that is 0.55%, 0.86%, and 1.81% .The real-time PCR method with D-loop primers F4 and R4 did not detect the presence of flesh DNA monkey in 12 meatballs market in Yogyakarta. The result demostrate the capability of real-time PCR with primer F4 and R4 for identification macaca in the processed food.

Kata Kunci : Macaca fascicularis, D-loop primers, real-time PCR, sequencing, authentification.