Laporkan Masalah

Pengembangan Immunodot Blot dan Reverse Transcription-Polymerase Chain Reaction Untuk Diagnosa Koksidiosis Eimeria tenella.

TRESNANI, Galuh, Joko Prastowo

2012 | Disertasi |

Koksidiosis atau penyakit berak darah pada ayam merupakan penyakit infeksi pada yang salah satu penyebabnya adalah parasit Eimeria tenella. Di Indonesia, morbiditas akibat koksidiosis dapat mencapai 80 hingga 90%. Diagnosa yang cepat dan tepat sangat dibutuhkan untuk mencegah penyebaran penyakit ini. Penelitian ini bertujuan untuk mengembangkan metode immunodot blot dan reverse transcription-PCR untuk mendiagnosa koksidiosis akibat infeksi E. tenella. Sampel oosista E. tenella diperoleh dari lapangan dan diperbanyak dengan cara ayam diinfeksi oosista, kemudian sekumnya diambil setelah masa inkubasi. Sampel oosista, sporosista, dan sporozoit E. tenella kemudian digunakan dalam analisa Western Blot, dan analisa RT-PCR. Analisa SDS-PAGE menunjukkan profil protein dengan 5 pita protein pada sporozoit dengan berat molekul 15 – 91 kDa. Protein ini kemudian diuji dengan immunodot blot dan memberikan hasil reaksi positif antara antigen dan antibodi. Analisa dilanjutkan dengan Western Blot tetapi hasil dari analisa ini belum berhasil memperoleh profil protein antigenik. Hasil analisa RT-PCR mendeteksi gen IHC-BiP yang memiliki ukuran antara 700 – 800 bp pada stadium sporosista. Hal ini menunjukkan bahwa gen ini hanya terekspresi pada peristiwa sporulasi. Kesimpulan pada penelitian ini adalah profil protein antigenik E. tenella belum berhasil diperoleh, namun diagnosa koksidiosis secara serologi masih dapat dikembangkan melalui pengembangan antibodi poliklonal untuk diagnosa dengan menggunakan teknik immunodot blot. Kesimpulan lainnya adalah diagnosa koksidiosis akibat infeksi E. tenella secara molekular dapat dikembangkan dengan metode RT-PCR melalui deteksi gen IHC-BiP. Kesimpulan lain yang juga dapat dikemukakan adalah bahwa gen IHC-BiP hanya mampu ditemukan pada stadium sporosista dan primer yang didesain mampu untuk mendeteksi gen tersebut adalah primer sense 3’ACGATCTTGGTGGTGGTACC5’ dan promer antisense 3’AGCGGACTGGTTGTCAGAGT5’. Kata kunci : Eimeria tenella, koksidiosis, diagnosa, Western Blot, RT-PCR

Coccidiosis or bloody-diarrhea disease in chicken is the infectious diseases caused by one of the protozoan parasite Eimeria tenella. In Indonesia, the morbidity due to coccidiosis is about 80 to 90%. The rapid and accurate diagnoses needed to prevent the distribution of this disease. This research aim is to develop the immunodt blot and reverse transcription-PCR methods for diagnosing of coccidiosis due to E. tenella infection. The oocysts sample of E. tenella were collected from the field and were propagated by injected the oocyst to the chickens, and collect the caecum after incubation periods. The oocysts, sporocysts, and sporozoites of E. tenella were then used for Western Blot and RT-PCR. The SDS-PAGE result showed that there were 5 protein bands found in the sporozoite of E. tenella with molecular weight between 15 to 91 kDa. These proteins were then tested with immunodot blot and gave positive reaction between antigen and antibody. The analysis was then continued with Western Blot but there were no antigenic protein profile found from this analysis. The RT-PCR result showed that the IHC-BiP gene was detected in sporocyst with molecular length between 700 – 800 bp. This means that the gene only expressed during sporulation. In conclusion, the profile of antigenic protein from E. tenella could not be found, but the serological diagnoses still can be developed through the development of polyclonal antibody for immunodot blot. Another conclusion, the molecular diagnoses of coccidiosis due to the infection of E. tenella can be developed using RT-PCR method to detect the IHC-BiP gene. Finally, from the research we can conclude that the IHC-BiP gene can only be found at sporocyst stadium, and the primer designed to detect that gene are the forward primer 3’ACGATCTTGGTGGTGGTACC5’ and the reverse primer 3’AGCGGACTGGTTGTCAGAGT5’. Keywords : Eimeria tenella, coccidiosis, diagnoses, Western Blot, RT-PCR

Kata Kunci :


    Tidak tersedia file untuk ditampilkan ke publik.