Laporkan Masalah

Analisis sekuen deoxyribonucleic acid (DNA) repetitif genom Toxoplasma gondii isolat lokal

SUMARTONO, Promotor Prof. drh. Charles Rangga Tabbu, M.Sc., PhD

2009 | Disertasi |

Diagnosis toksoplasmosis masih perlu dikembangkan. Genom Toxoplasma memiliki sekuen DNA repetitif yang besarnya 529bp, dengan jumlah kopi sampai lebih dari 300 kali. Sekuen DNA repetitif tersebut memiliki potensi sebagai pelacak molekuler. Penelitian ini bertujuan untuk menganalisis homologi sekuen DNA repetitif genom T. gondii isolat lokal dengan sekuen DNA repetitif genom Toxoplasma lainnya, serta homologi dengan genom protozoa lain yang secara filogenetik dekat dengan Toxoplasma dan mengeksplorasi karakteristik fragmen dari sekuen DNA repetitif tersebut sebagai pelacak molekuler. Genom Toxoplasma diisolasi dari 6.107 takizoit T. gondii isolat RH dan 8.107 takizoit isolat lokal dengan metode lisis alkali. Amplifikasi sekuen DNA repetitif menggunakan forward primer Tox-8: 5’- CCC AGC TGC GTC TGT CGG GAT-3’, reverse primer Tox-5: 5’-GAC GTC TGT GTC ACG TAG ACC TAA-3’, dan ready to go beads (Amarsham), sedang sekuensing produk PCR menggunakan big dye terminator mix dengan sequenser ABI 377A di laboratorium Biologi Molekuler Eijkman, Jakarta. Analisis sekuen DNA repetitif dilakukan untuk mengetahui kesamaan sekuen diantara Toxoplasma, kesamaan dengan protozoa lain yang secara filogenetiknya dekat dengan Toxoplasma, sedang analisis sebagai perangkat diagnosis molekuler dilakukan dengan karakterisasi fragmen sebagai bahan pelacak menggunakan high prime DNA labeling and detection starter Kit. Kesimpulan penelitian ini adalah bahwa sekuen DNA repetitif genom Toxoplasma isolat lokal sangat homolog dengan isolat RH tetapi berbeda dengan sekuen repetitif genom Toxoplasma yang ada pada genBank dan tidak ditemukan pada genom protozoa yang secara filogenetik dekat dengan Toxoplasma. Sebanyak 80 nt diantaranya dengan urutan nukleotida tcatcctcaccctcgccttcatctacagtcctgatatctctcctccaagaggctggagagcggcatcgcgtctgtagt dari fragmen genom tersebut memiliki perspektif sebagai pelacak molekuler. Penggunaan 24,47 pg dari molekul tersebut dapat mendeteksi komplementernya pada DNA target sampai 1500 pg untuk isolat lokal, dan 1250 pg untuk isolat RH.

Diagnosis of toxoplasmosis is still necessary to be developped. Repetitive sequences of 529 bp can be found more than 300 copies in a T. gondii genome, therefore it has a potency to be used as a molecular probe. The aim of this research was to analyse the homology of repetitif DNA sequence of the genome of Toxoplasma local isolate in comparison with other Toxoplasma sp., and other protozoa genome which phylogenetically closed to Toxoplasma and to explore a fragment of the sequence as a molecular probe. Tachyzoite genome was isolated using alkaly lysis from 6x107 tachyzoites of RH isolate and 8x107 tachyzoites of local isolate. Target sequence was amplified by Polymerase Chain Reaction (PCR) method using Tox-8: 5’- CCC AGC TGC GTC TGT CGG GAT-3’ Tox-8), as forward, 5’- GAC GTC TGT GTC ACG TAG ACC TAA-3’ (Tox-5), as as reverse primer, and ready to go beads (Amarsham ). PCR products was sequenced using big dye terminator mix through ABI 377A sequencer at Molecular Biology Eijkman Laboratory, Jakarta. This analysis was carried out in order to study the sequence homology among repetitive DNA sequence of Toxoplasma and protozoa that phylogenetically closed to Toxoplasma. Whereas, the study for its potency as a molecular probe was done by characterizing the repetitive fragment using high prime DNA labeling and detection starter Kit. This research concluded that the repetitive DNA sequence of Toxoplasma genome of local isolate is highly homolog to those in the genome of RH isolate. This sequence has some differences with the repetitive DNA sequence of Toxoplasma available in the genBank and has no homology with the genome sequences of other protozoa which phylogenetically closed to Toxoplasma. The fragment of 80 nt consisted of tcatcctcaccctcgccttcatctacagtcctgatatctctcctccaagacggctggagagcggcatcgcgtct gtagt has perspective as a moleculer probe. At a dose of 24,47 pg, the fragment could detect its complementer on 1250 pg DNA target of RH isolate and 1500 pg DNA target of local isolate.

Kata Kunci : Genom Toxoplasma,Sekuen DNA repetitif,Pelacak molekuler,Toxoplasma genome, repetitive DNA sequence, probe


    Tidak tersedia file untuk ditampilkan ke publik.