IDENTIFIKASI MORFOLOGI DAN MOLEKULER Culicoides spp. PADA PETERNAKAN AYAM PETELUR KOMERSIAL BERBEDA WILAYAH TOPOGRAFI

KARTIKA YUGA W, Dr. drh. Joko Prastowo, M.Si.; Dr. drh. Bambang Sutrisno, M.P.

2017 | Tesis | S2 Sain Veteriner

Culicoides spp. merupakan vektor utama diptera yang paling fokus dipelajari, salah satunya merupakan vektor dari Leucocytozoon yang menyebabkan Leucocytozoonosis. Seratus spesies Culicoides spp. tercatat di Indonesia yang tersebar pada 19 daerah provinsi dan menunjukkan adanya keragaman spesies pada masing-masing wilayah. Tujuan penelitian untuk mengidentifikasi keragaman spesies dan variasi genetik Culicoides spp. di peternakan ayam petelur komersial pada wilayah dengan topografi yang berbeda. Sampel diperoleh dari peternakan ayam petelur komersial di Kecamatan Sentolo, Kabupaten Kulon Progo (ketinggian 78 mdpl); Kecamatan Pakem, Kabupaten Sleman (ketinggian 371 mdpl); Kecamatan Cangkringan, Kabupaten Sleman (ketinggian 745 mdpl). Koleksi sampel menggunakan perangkap serangga berupa perangkap lampu New Jersey Standard tipe 2858 selama 12 jam dimulai dari jam 18.00 WIB hingga jam 06.00 WIB. Identifikasi spesies secara morfologi dengan pengamatan mikroskopik menggunakan mikroskop dissect dan diklasifikasikan berdasarkan kunci identifikasi dari With dan Hubbert. Identifikasi molekuler dengan metode polymerase chain reaction (PCR) menggunakan primer universal 18S dengan forward primer (5- GTCTTGTACCGACGACAGAT -3) dan reverse primer (5- CCTCTCGCGTCGTAATACT -3), kemudian dilanjutkan sekuensing. Hasil identifikasi morfologi dianalisis secara deskriptif sedangkan hasil identifikasi molekuler dianalisis menggunakan metode Basic Local Alignment Search Tool (BLAST) dan software Molecular Evalutionary Genetics Analysis (MEGA). Hasil penelitian diperoleh delapan spesies yaitu C. arakawae, C. huffi, C. oxystoma, C. guttifer, C. sumatrae, C. peregrinus, C. palpifer, dan C. fulvus. Terdapat keragaman spesies pada ketiga wilayah penelitian. Culicoides arakawae merupakan spesies yang dominan ditemukan di Sentolo, sedangkan di Pakem adalah C. huffi dan di Cangkringan adalah spesies C. fulvus. Hasil koleksi Culicoides di Sentolo paling banyak yaitu sebanyak 270 ekor. Terdapat keragaman genetik pada spesies C. peregrinus sebesar 0,5%, sedangkan pada spesies C. arakawae dan C. huffi di masing-masing wilayah tidak terdapat keragaman genetik atau homolog 100%. Hubungan kekerabatan C. arakawae lebih dekat dengan C. peregrinus dibandingkan dengan C. huffi. Jarak genetik sampel yang diteliti dengan Culicoides sp. A2 (GenBank LC128700.1) berkisar 4,8 - 5,8 % (homologi 94,2 - 95,2%).

Culicoides spp. is the most studied vector, one of which is a vector of Leucocytozoon that causes Leucocytozoonosis. One hundred species of Culicoides spp. notes in Indonesia are scattered in 19 provinces and indicate the presence of species diversity in each region. This study aims to identify species diversity and genetic variation of Culicoides spp. on commercial egg - laying farms with different topographies. Midges were obtained from laying farm in Sentolo, Kulon Progo (altitude 78 m); Pakem, Sleman (altitude 371 m); Cangkringan, Sleman (altitude 745 m). Midges were collected by light trap (New Jersey Standard 2858) for 12 hours, from 6 p.m. to 6 a.m. Morphological identification using dissect microscope and classified by key identification of With and Hubbert. Molecular identification using the primary universal 18S with forward primer (5- GTCTTGTACCGACGACAGAT -3) and reverse primer (5-CCTCTCGCGTCGTAATACT -3), followed by sequencing. The results of morphological identification were analyzed descriptively while the result of molecular identification was analyzed using Basic Local Alignment Search Tool (BLAST) and Molecular Evalutionary Genetics Analysis (MEGA) software. Eight species were found in this study, there are C. arakawae, C. huffi, C. oxystoma, C. guttifer, C. sumatrae, C. peregrinus, C. palpifer, and C. fulvus. There are species diversity in the three research areas. Culicoides arakawae is the dominant species found in Sentolo, while in Pakem is C. huffi and in Cangkringan is C. fulvus. Collection of Culicoides at Sentolo is the most found (270 midges). There is a genetic diversity in C. peregrinus species of 0.5%, whereas species C. arakawae and C. huffi in each region have no genetic diversity (homology 100%). Relationship of C. arakawae is closer to C. peregrinus compared with C. huffi. The genetic distance of the studied sample with Culicoides sp. A2 (GenBank LC128700.1) ranged from 4.8 to 5.8% (homology 94.2 - 95.2%).

Kata Kunci : Identifikasi, Culicoides spp, gen 18S, topografi